تعیین الگوی ژنتیکی و تشخیص ژن کارباپنماز کلبسیلا پنومونیه در جدایه‌های مقاوم به کارباپنم خانواده انتروباکتریاسه جداشده از بیمارستانهای شهر اصفهان

Introduction

Carbapenems have been a major advancement in the treatment of beta-lactam-resistant bacteria because of their wide spectrum of activity and the resistance to hydrolysis by most β-lactamases (1). Carbapenems are selective drugs for the treatment of penicillin-resistant or cephalosporin-resistant gram-negative bacterial infections by inhibiting their cell wall synthesis (1-3). The production of plasmid-mediated carbapenem-hydrolyzing beta-lactamases is increasing among gram-negative bacteria, especially the Enterobacteriaceae family. (4, 5). Resistance to carbapenems is accomplished through specific mechanisms that include increasing the activity of antibiotic exit system, reducing the expression of the outer membrane proteins that are essential for the entrance of antibiotics and the production of carbapenem-hydrolyzing enzymes that can make carbapenems inactivate with hydrolysis (1-5).

Beta-lactamase enzymes are grouped into four main groups from A to D based on their amino acid sequence (1). Among the Carbapenemase enzymes, in group A, KPC (an abbreviation for Klebsiella pneumoniae Carbapenemase) is found on transportable plasmids and therefore can rapidly exchange among different bacteria and cause high levels of resistance (6). The first member of the KPC family (KPC-1) was reported in a clinical isolate of Klebsiella pneumoniae from North Carolina in the United States in 1997 (7). Following the discovery of the KPC-1, another KPC with differences in an amino acid, KPC-2, was quickly found across the United States (8). The KPC-producing bacteria are very important because their therapeutic options are very limited and they are usually sensitive to polymyxin or tigecycline antibiotics, which are considered to have high side effects (9). Up to now, 17 new subtypes of this gene (KPC1 to KPC17) have been identified and reported by mutations to the original genes in the world (1). Detection of the bacteria resistance and the type of resistance mechanism is important in order to achieve the best solution for their elimination (10). On the other hand, determining the antibiotic susceptibility pattern of these bacteria in order to obtain effective and usable antibiotics against these bacteria is essential in their treatment (11).

The aim of this study was to investigate antibiotic pattern (Resistotyping) and genotyping of carbapenem-resistant Enterobacteriaceae family isolates and evaluation of phenotypic and molecular detection of Klebsiella pneumoniae carbapenemase (KPC) enzymes in Enterobacteriaceae isolates.

 Materials and Methods

Isolation and Identification of Bacteria:Different strains of Citrobacter, Enterobacter and Escherichia coli bacteria were isolated and identified from different clinical specimens of the three hospitals of Isfahan during the 16 months. Identification of isolates was carried out using standard phenotypic methods (12).

Determination of Antibiotic susceptibility pattern:Antibiotic susceptibility test was determined in isolated strains according to the 2016 guidance of the Clinical Laboratory Standards Institute (CLSI)) by disc diffusion method (13). These antibiotics include imipenem, meropenem, ertapenem, doripenem, gentamicin, ampicillin, amikacin, ciprofloxacin, levofloxacin, cefepime, piperacillin/tazobactam, nitrofurantoin (for urinary tract infections) cefotaxime and ceftazidime (purchased from Mast Company, UK).

Determination of the Minimum Inhibitory Concentration (MIC):Minimum Inhibitory Concentration (MIC) was used by Etest method for meropenem and imipenem resistant as explained previously (13) by Etest strips (purchased from Biomerieux Company, France).

Phenotypic Detection of KPC Enzyme:According to the proposal of the CLSI Institute, to evaluate phenotypic detection of KPC, resistance to one or more antibiotic in carbapenem family or resistance to one or more antibiotics in third-generation cephalosporins was used for the primary KPC identification (14). The confirmatory assay of the KPC production was performed by Modified Hodge Test (MHT) and the combination test using Boronic acid as described previously (14, 15).

bla_KPC Gene Molecular Identification:A pair of specific primers of the bla_KPC gene (forward primer: 5-CTGTCTTGTCTCTCATGGCC-3 and reverse primer: 5-CCTCGCTGTGCTTGTCATCC-3) were used to identify bla_KPC gene (16). The PCR program was as follows: initial denaturation for 3 minutes at 94°C, then 30 cycles with initial denaturation temperature at 94° C for 30 seconds, annealing step at 56° C for 40 seconds, extension stage at 72°C for 60 seconds, and final elongation step at 72°C for 7 minutes (16). All positive gene products will be sequenced to determine their possible mutations and the type of subtype of the enzyme present.

Clonal Relationship of Carbapenems Resistant Strains using ERIC-PCR:Enterobacterial Repetitive Intergenic Consensus Polymerase Chain Reaction (ERIC-PCR) method was used for the determination of the clonal relationship of carbapenems resistant strains by ERIC1R primer (ERIC1R: ATGTAAGCTCCTGGGGATTCAC) as previously was described (17) and dendrograms were drawn by Gelj v.1.3 Software.

Statistical Methods:All calculations were done with SPSS version 22 statistics software (IBM Corp., Armonk, NY, USA) and the Microsoft Excel 2010 software. A chi-square test was performed to compare categorical data. P-values less than 0.05 were considered to be statistically significant.

Results

During 16 months of study, 520, 146 and 58 strains of Escherichia coli, Enterobacter spp. and Citrobacter spp. were isolated and identified respectively. The number of bacteria isolated according to each clinical specimen is given in Table 1. As it shows, most strains were isolated from urine.

Table 1- Distribution of Isolated Bacteria

.Antibiotic Susceptibility Pattern of Isolates:In all strains of three bacteria, effective antibiotics were carbapenems, piperacillin/tazobactam, amikacin, cefepime, fosfomycin (for urine isolates of E. coli), gentamicin and nitrofurantoin (for urine isolated strains) and most resistance was observed to ampicillin and trimethoprim/sulfamethoxazole (Table 2). About half percentages of the strains of three bacteria were resistant to third generation cephalosporins, including cefotaxime and ceftazidime. In addition, 12 strains of E. coli (2.3%), 4 strains of Enterobacter (2.7%) and 4 strains of Citrobacter (6.9%) were resistant to carbapenems (Table 2).

Table 2- Percentages of Susceptible (S), Resistant (R) and Intermediate (I) to different antibiotics in isolated bacteria.

.Phenotypic and Molecular Detection of KPC Enzyme: The result of phenotypic and molecular detection of KPC enzyme among strains thatwere resistanttothird generation cephalosporins and carbapenems are shown in Table 3. This results showed that by MHT method, 12, 1 and 5 strains of E. coli, Citrobacter spp. and Enterobacter spp.were KPC producers, respectively, and these results byBoronic acid were 4, 0 and 2 strains.No bla_KPC gene was observed using PCR method in these isolates.

Table 3- The result of phenotypic and molecular detection of KPC enzyme among strains that were resistant to third generation cephalosporins and carbapenems.

.Clonal relatedness of carbapenem-resistant strains:The clonal relatedness dendrogram using ERIC-PCR of carbapenem-resistant strains are shown in Figure A1, A2, and A3. As shown in Figure A1, in four carbapenem-resistant Citrobacter strains, three main clusters were observed. The strain 1 and strain 4 that were isolated from two different hospitals were in the distinct clusters and had a different genetic relationship (less than 80% relationship) and strains 2 and 3 isolated from the same hospital had a close genetic similarity (94% relationship). The four carbapenem-resistant strains of Enterobacter isolated from two different hospitals had four main clusters and were not genetically related (less than 70% relationship) as it is shown in Figure A2. In addition, in carbapenem-resistant strains of Escherichia coli 9 main clusters were observed. As showed in figure A3, there was no genetic relationship between strains No. 1, 2, 5, 8, 9 and 10. Strains 3 and 4 with 96% genetic relationship and strains 6, 7 and 11, 12 strains with 92% genetic relationship were isolated from different hospitals but were similar in antibiotic resistance pattern (Table 2).

Fig. 1- Clonal relatedness dendrogram using ERIC-PCR of carbapenem-resistant strains; a three main clusters in Citrobacter strains, b four main clusters in Enterobacter strains, c nine main clusters in Escherichia coli strains.

 Discussion and Conclusion