| تعداد نشریات | 44 |
| تعداد شمارهها | 1,891 |
| تعداد مقالات | 15,352 |
| تعداد مشاهده مقاله | 44,706,170 |
| تعداد دریافت فایل اصل مقاله | 17,968,469 |
فعالیت بازدارنده برخی از باکتریهای اندوفیت برگSatureja khuzestanica در برابر باکتریهای بیماریزای گیاهی | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| زیست شناسی میکروبی | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| مقاله 13، دوره 11، شماره 44، دی 1401، صفحه 145-158 اصل مقاله (719.89 K) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| نوع مقاله: پژوهشی- انگلیسی | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| شناسه دیجیتال (DOI): 10.22108/bjm.2022.134522.1482 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| نویسندگان | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| میترا امیدی نسب1؛ غلام خداکرمیان* 2 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| 1دانشجوی دکتری گروه گیاهپزشکی، دانشکدۀ کشاورزی، دانشگاه بوعلیسینا، همدان، ایران | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| 2استاد گروه گیاهپزشکی، دانشکدۀ کشاورزی، دانشگاه بوعلیسینا، همدان، ایران | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| چکیده | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| چکیده مقدمه: میکروبهایی که درون بافتهای گیاهی قرار دارند، به نام اندوفیت شناخته میشوند. این میکروبها مجموعهای از ترکیبات را تولید میکنند که قابلیت استفاده در پزشکی و کشاورزی مدرن را دارند. هدف از این مطالعه جداسازی، غربالگری و شناسایی باکتریهای اندوفیت با فعالیت ضدمیکروبی علیه باکتریهای پاتوژن گیاهی بود. گیاهان دارویی مانند Satureja khuzestanica بهدلیل داشتن برخی متابولیتهای ثانویه در طب سنتی استفاده میشوند؛ اما اطلاعات مربوط به اندوفیتهای باکتریایی طبیعی آن محدود است. مواد و روشها: در مطالعه حاضر، 27 سویه اندوفیت از S. khuzestanica جداسازی شد. براساس توالییابی ژن 16S rRNA، سویههای باکتریایی جداشده با بیشترین فعالیت در برابر باکتریهای بیماریزای گیاهی متعلق به جنسهای Bacillus، Streptomyces و Pseudomonas بودند. متابولیتهای ثانویه زیستفعال این باکتریهای اندوفیت با استفاده از اتیل استات استخراج شدند و سپس آنالیز کروماتوگرافی گازی - طیفسنجی جرمی (GC-MS) در شرایط استاندارد انجام شد. حداقل غلظت مهاری (MIC) برای پنج گونه باکتری با روش رقت میکروبراث تعیین شد. نتایج: تجزیه و تحلیل دادهها نشان دادند تفاوت معنیداری برای فعالیت ضدمیکروبی ثبت شد که حداقل غلظت بازداری آن از 312/0 میلیگرم بر میلیلیتر تا 5/2 میلیگرم بر میلیلیتر بود. حداقل غلظت باکتریکشی 625/0 میلیگرم بر میلیلیتر تا 10 میلیگرم بر میلیلیتر بود. بحث و نتیجه گیری: ترکیبات اصلی در تجزیه و تحلیل GC-MS باکتریهای اندوفیت در این مطالعه 2،4-di-tert-butylphenol ، beta-d-glucopyranose ، hexadecane، tetradecane، eicosane و dibutyl phthalate بودند. این مطالعه برای نخستینبار اندوفیتهای باکتریایی S. khuzestanica با فعالیت ضدمیکروبی علیه فیتوپاتوژنهای باکتریایی را گزارش میدهد. یافتههای ما بینش جدیدی را دربارة فعالیتهای ضدمیکروبی باکتریهای اندوفیت طبیعی S. khuzestanica ارائه میدهد. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| کلیدواژهها | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| باسیلوس؛ استرپتومیسز؛ سودوموناس؛ کروماتوگرافی | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| اصل مقاله | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
Introduction How did medicinal herbs usage start- from nature or planting is unknown. However, historically, in the great civilizations of the world, medicinal plants have been used as the main agent in the healing and treatment of pain. In the late eighteenth and early nineteenth centuries, scientific studies on medicinal plants were expanded and medicinal plants were used as scientifically important medicinal agents (1). Iran is one of the centers of diversity of Satureja species. The genus Satureja belongs to the Lamiaceae family and the Nepetoideae subfamily. S. khuzestanica grows naturally in the western and northwestern parts of Iran (2, 3). S. khuzistanica and S. reshingeri are valuable herbs used in pharmaceutical and food industries due to their pharmacological and biological properties (4). Recently a wide range of biological activities of S. khuzestanica have been reported such as antibacterial (5, 6, 7, 8), antifungal (9, 10), antiparasitic (11, 12), antioxidant (13, 14, 15, 16, 17, 18), and anti-inflammatory (7, 15, 19, 20, 21,( properties. Bacterial endophytes are obligate symbiotic microorganisms, which live in apparently healthy internal plant tissues, without causing disease (22). Endophytic bacteria can be found in most plant species and can be recovered from various parts of the plant including roots, leaves, stems, and a few from flowers, fruits, and seeds (23). Endophytic microorganisms affect plant physiology through activities such as biocontrol roles, plant growth regulation, bioremediation, symbiotic-mutualistic, commensalistic, and trophobiotic interactions, control of pathogens, and support of host plants (24). Endophytes help to improve crop yields, through an immune response and stimulating plant growth, excluding plant pathogens through niche competition, and antioxidant activities (25). They have the potential to produce a variety of secondary metabolites with applications in the agriculture and pharmaceutical sectors (23, 24, 26). Several secondary metabolites produced by bacterial endophytes act as antimicrobial agents against human, animal, and plant pathogens. Whereas the antimicrobial effect against phytopathogens will have a positive effect on the host plant, the efficacies of endophyte metabolites may show great clinical potential for medical and livestock treatments. Indeed, antibiotics are low-molecular-weight products made by microbes that inhibit the growth or kill phytopathogens agents such as bacteria, fungi, viruses, and protozoans (27, 28). Many important antibiotics are produced by endophytes in different plant species (29). However, only a few of all the plants existing on earth have ever been studied regarding their bacterial endophytic pool (30), increasing the probability to find new and beneficial endophytes with the potential to be applied in biotechnology. The microbiome of medicinal plants is extremely important because of increasing evidence on the spectrum of bioactive metabolites related to the activity of associated bacterial endophytes (31). Plant diseases caused by bacterial pathogens pose major constraints in crop production and cause significant annual damage worldwide (32). New and emerging bacterial disease problems and established problems in new geographical regions grab the headlines (32). Many bacterial pathogens predominantly colonize internal locations within plants that are inaccessible to most spray-applied chemical and biological pesticides that target plant surfaces (33). Management strategies for plant bacterial diseases require great knowledge of the environmental conditions in order to identify the most suitable time for targeting the pathogen populations and to determine when the acute host tissues are sensitive to infection. The major pathogens of plants are parasitic plants, fungi, viruses, nematodes, and bacteria. (34). The most important bacterial ones belong to the genera of Agrobacterium, Ralstonia, Pectobacterium, Xylella, Erwinia, Xanthomonas, Pseudomonas, and Dickeya. An integrated management approach, including the use of plant host resistance, chemical intervention and biological controls, and cultural practices for inoculum reduction, typically represents the best strategy for effective and stable disease management
Materials and Methods Plant Material/Samples Collection: S. khuzestanica leaves samples were collected from three different areas including Lorestan, Khuzestan, and Ilam provinces located in the south and southwest of Iran. Plant leaves were cut and placed separately in polythene bags to avoid moisture losses and stored at 4oC for further investigation. Isolation of Endophytic Bacteria: Briefly, leaves were washed under tap water to remove dust, and disinfected by sequential immersion in 70% ethanol for 5 minutes or sodium hypochloride for 20 minutes. Finally, and disinfected leaves were washed three times in sterilized distilled water and soaked in 10% NaHCO3 solution to disrupt the plant tissues and inhibit the growth of fungi (35). A gram of each leave sample was homogenized in potassium phosphate buffer (pH 7.0) followed by serial dilutions preparation. For isolation of endophytic bacterial strains, a loopful of homogenate samples was stork on modified Tryptic soy agar (TSA) and nutrient agar (NA) in three replications and incubated at 28 ºC for three days. Bacterial single colonies were selected based on their phenotypic characteristics such as colony morphology, color, and growth rate. They were kept in sterilized distilled water at 4 °C for further investigation. Determination of Antibacterial Activity: Purified endophytic bacterial strains were grown on Tryptic Soy Broth (TSB) medium and their antibacterial activity against the phytopathogens R. solanacearum, P. carotovorum, and C. michiganensis, was determined in a randomized design in three replicates, and inhibition zone data were recorded and analyzed (24). Analysis of the variance of data was done based on a randomized complete design with three replications. The resulting data were analyzed using SAS software, and a comparison of means was done through Duncan's multiple range test. Identification of Efficient Endophytic Bacteria: Phenotypic features of the efficient bacterial strains were determined based on standard bacteriological methods followed by 16S rRNA amplification and sequencing. For the extraction of bacterial genomic DNA, 50 mg of the freshly grown colonies was transferred into a 1.5 ml Eppendorf tube, and 480 µl TE buffer and 20 µl lysozyme solution (2 mg/ml) were added. The bacterial suspension was mixed and placed in a shaker incubator for 1 h, treated with 50 µl SDS solution 20 % and 5 µl Proteinase K solution, and kept in a bain-marie at 55 °C for 1 h. The bacterial DNA was extracted twice with phenol-chloroform-isoamyl alcohol, followed by precipitation with 80 µl sodium acetate (3 mol/l, pH 5) and 800 µl absolute ethanol. The DNA precipitate was centrifuged at 12000 rpm for 10 min, washed with ethanol 70 %, and air-dried. The extracted DNA was resuspended in 40 µl sterilized distilled water and stored at -20°C for further use (36). For the amplification of 16S rRNA genes, the extracted DNA was subjected to a polymerase chain reaction (PCR) using 16SF- (AGAGTTTGATCCTGGCTCAG) and 16SR- (GGTTACCTTGTTACGACTT) primers (37). The PCR program for 35 cycles was as follows: DNA denaturation at 94 °C for 5 minutes, annealing for 30 seconds at 53 °C, and extension for 60 seconds at 72 °C. The PCR products were purified with a PCR purification kit (Macherey-Nagel, Germany) and subjected to sequencing (Bioneer Korea Co.). The obtained sequences were analyzed using BLAST software in the GenBank database NCBI. Preparation of Cell-free Supernatant from Efficient Bacterial Strains: Selected bacterial strains were cultured in 250 ml Erlenmeyer flasks containing 100 ml of standard medium (TSB+ 0.1 g of MgSO4 7H20, 0.1 g of KC1, 0.05 g of KH2PO4, 0.05 g of K2HPO4, 0.2 g of CaC12 2H20, 0.4 g of yeast extract, 0.4 g of malt extract, 0.2 mL of trace elements, pH 7.2), incubated at 27 °C for 3 days in a shaker incubator at 160 rpm. A total of one-liter volume of culture broth was centrifuged at 8000 rpm at 4 °C for 15 min and was filtered through Whatman no.1 filter paper. The spent culture broth was aseptically transferred into 250 ml flasks, and an equal volume of 1:1 (v/v) of ethyl acetate was added. This mixture was shaken vigorously for 30 min and was kept stationary for another 15 min to phase separation. The solvent was dried in a rotary evaporator under a vacuum to obtain the crude metabolite (38). The remaining residues were dried in a vacuum desiccator, re-dissolved in a small volume of ethyl acetate (1mg/ml), and stored at -20 °C for further use (39). A total of 2 μl of the ethyl acetate extract from each bacterial strain was used for GC/MS analysis. New unknown metabolites from bacterial crud extract were characterized using GC-MS [SHIMADZU QP2010] instrument (GC column oven temperature 35 °C, injector temperature 250 °C at split mode ratio 100 with a flow rate 1.25 ml/min). The MS with ion source temperature 200 °C, interface temperature 250 °C, scan range 45-450 m/z, event time 0.3 sec, solvent cut time 1 min, MS start time: 1 min, MS end time 50 min, ionization EI (-70ev) was employed for metabolites characterization. Minimum Inhibitory Concentration (MIC) and Minimum Bactericidal Concentration (MBC) Determination: The minimum inhibitory concentration of crude extracts of bacterial endophytes was determined according to Andrews’ method (40) with some modifications. Briefly, the extracted solutions were prepared by dissolving 0.02 g/ ml in dimethyl sulfoxide (DMSO) and diluted to a final concentration of 20 mg/ ml in nutrient broth medium followed by preparation of serial dilution including 10 mg/ ml, 5 mg/ ml, 2.5 mg/ ml, 1.25 mg/ ml, 0.625 mg/ ml, and 0.312 mg/ ml in the same medium. Using McFarland standard number 0.5 (108 × 1.58 CFU/ ml) as a reference, a volume of 50 μl suspension of each sample was inoculated in 15 ml of nutrient broth medium and incubated for 24 hours at 28 °C. The 96-well microtiter plates were employed, and a volume of 100 μl of phytopathogenic bacterial strain suspension was added horizontally followed by adding 100 μl of prepared diluted crude extract at different concentrations vertically from top to bottom. The negative controls were 100 μl DMSO and 100 μl nutrient broth medium, and the positive control was 1 mg/ ml streptomycin (Sigma-Aldrich Switzerland). Three replicates were employed for each sample and plates were incubated for 24 hours at 28 °C. MIC values (lowest concentration of each extract without visible growth) were determined visually. Identification of Bioactive Metabolites: The volatile and semi-volatile secondary metabolites from the crude extracts of bacterial strains were analyzed by GC–MS (SHIMADZU QP2010, 41 Osama A. A. Mohamad). Accordingly, for GC-MS analysis, a Shimadzu model GC 2010 Plus (Kyoto, Japan) gas chromatograph coupled with a Shimadzu Quadruple-MS model QP2010 SE mass spectrometer was used. Secondary metabolites were separated on a 30 m × 0.22 mm i.d. fused-silica capillary column coated with 0.25 μm film of BP-5 (Shimadzu), and a splitless injector with a 1 mm internal diameter glass liner. The Shimadzu Quadruple-MS model QP2010 SE mass spectrometer was used to identify volatile and semi-volatile secondary metabolites from the crude extract of bacterial strains. Also, an HP-5MS fused silica capillary column was applied (Hewlett-Packard, 30 m × 0.25 mm i.d. 0.25 μm film, cross-linked to 5% phenyl methyl siloxane stationary phase). The entire system was checked using ChemStation software (Hewlett- Packard, version A.01.01). Electron impact mass spectra were recorded at 70 eV, and ultra-high pure (99.999%) HAE gas was used as the carrier gas at a flow rate of 1 ml. min−1. The injection volume was found to be 1 μl, and all injections were done in a split-less mode. The injector and detector temperature settings were 250 °C and 280 °C, respectively. The column oven temperature was set initially at 35 °C for 5 min, then raised to 300 °C (ramp: 4◦C/min) and held for 20 min. The database of the National Institute of Standards and Technology (NIST) was applied to interpret the mass spectrum of GC-MS with more than 62000 patterns. Using the obtained data from NIST05 (National Institute of Standards and Technology, US) and WILEY 8 libraries, the existing bioactive compounds in bacterial crude extracts were identified through comparison to mass spectra. Finally, the molecular weights and structural metabolites formula of the tested bacterial metabolites were determined.
Results and Discussion Isolation and Determination of the Antibacterial Activity of Endophytic Bacterial Strains: Based on the different cultural conditions on the TSA medium, 27 endophytic bacteria were isolated from S. khuzestanica. All endophytic strains were screened for their antibacterial activity toward five plant pathogens. Based on the inhibitory activity of endophytic bacterial strains against the different species of plant pathogenic bacteria, the most bioactive five strains were selected as the representative (Table 1). They showed significant antibacterial activity against plant pathogenic bacteria strains with the diameter of inhibition zones as follows: 24 mm for P. carotovorum, 21 mm for R. solanacearum, 20 mm for B. nigrifluens, 17 mm for C. michiganensis, and 19 mm for E. amylovora. All values are the mean of three repetitions of independent experiments. The comparison of the average interaction effect of endophytic bacteria and pathogenic bacteria is presented in Table 2.
Table 1- Antagonistic Activity of Endophytic Bacterial Strains Isolated from Satureja khuzestanica against some Plant Pathogenic Bacteria
*numbers show inhibition zone in mm
Table 2- Comparison of the average inhibitory effect of the endophytic bacterial strains against plant pathogenic bacteria in vitro
Different letters between rows indicate a significant difference at the 1% probability level
Representative bacterial strains (MON 01, MON 02, MON 05, MON 06, and MON 07) were identified based on their 16S rRNA gene sequences. They showed 99% homology with 16S rRNA encoding gene sequences of verified species and they submitted to the GenBank database with allocated accession numbers (Table 3). Bacteriostatic and Bactericidal Activity of the Bacterial Crude Extract: Metabolites from endophytic bacterial representative strains showed bacteriostatic and bactericidal activity against three Gram-negative and one Gram-positive phytopathogenic bacteria. Ethyl acetate extracts showed bacteriostatic effects with MIC ranging from 0.312 to 5 mg/ ml and bactericidal activity ranging from 0.625 to 20 mg/ ml (Table 4, 5).
Table 3- NCBI 16S rRNA Genes of Endophytic Bacterial Strains Isolated from Satureja khuzestanica Accession Number
Table 4- Minimum Inhibitory Concentrations of Crude Extracts of Secondary Metabolites of Bacterial Endophytes isolated from Satureja khuzestanica
Table 5- Minimum Bactericidal concentrations of crude extracts of secondary metabolites of bacterial endophytes isolated from Satureja khuzestanica of bacterial endophytes isolated from Satureja khuzestanica
.Detection of Bioactive Metabolites by GC-MS Analysis: Spectra of GC-MS from representative endophytic bacterial strains isolated from Satureja khuzestanica were interpreted by the database of the National Institute of Standards and Technology (NIST) with 62000 patterns. The chromatogram of bacterial metabolites was identified according to the peak area, retention time, and effect. Characterization metabolites from tested endophytic bacterial strains isolated from S. khuzestanica revealed that they have the capacity to produce bioactive agents. Among the 27 bacterial strains isolated from S. khuzestanica on the TSA medium, the most active representative was selected for identification based on the 16S rRNA gene sequences. The strain MON 02 was identified as Bacillus (Priestia) megaterium by 99% similarity to B. megaterium which was submitted in the GenBank under accession number OL342346. Its major constituent with 67.34 % area was Prodox (2, 4-Di-tert-butylphenol) at the retention time of 20.578, which is a common natural product that exhibits potent toxicity against almost all testing microbes, including the producing species (Table 6). The 2, 4-DTBP is found in 16 species of bacteria in 10 families, such as nitrogen-fixing cyanobacteria and Gram-positive bacteria such Bacillus. Bioactivities of 2, 4-DTBP as antibacterial activities, antiviral activities, antifungal activities, pesticides (Nematicidal activities), antioxidant activities, and anti-inflammatory activities are reported in the literature.
Table 6- GC-MS Analysis of Bacillus (Priestia) Megaterium Crude Extract Isolated from Satureja khuzestanica
Bacillus is a Gram-positive bacterium that has been used industrially for decades and its product portfolio is continuously growing. Its metabolites include enzymes such as α-amylases, β-amylases, penicillin G acylase, xylanase, hydrolases, and cytochrome monooxygenase. Furthermore, it has been shown that Bacillus spp. has well biocontrol properties by promoting plant growth and reducing plant diseases caused by both plant-pathogenic fungi and bacteria (42). These properties are mostly related to their secondary metabolite profiles (43). The strain MON 06 was identified as Pseudomonas fluorescens by 99.66 % similarity to P. fluorescens, which was submitted to the GenBank under accession number OL342347. One of its major constituents was Dibutyl phthalate (DBP) at the retention time of 13.820 (table 7). Dibutyl phthalate (DBP) is a bioactive ester produced by actinomycetes (44, 45), fungi (46), algae (47), and also higher plants (48). It acts as an antitumor and anticancer compound (49), and herbicide (50). Also, the cytotoxic activity of DBP against tumor cell lines has been evaluated by Mabrouk et al. (2008). The other identified metabolites from P. fluorescens were beta-D-Glucopyranose (anti-bacterial and antioxidant) (51), Cyclo-Leu-Pro-diketopiperazine (antifungal) (52), and Staflex.
Table 7- GC-MS Analysis of Pseudomonas fluorescens Crude Extracts Isolated from Satureja khuzestanica
Strain MON 07 was identified as P. gessardii which was submitted to the GenBank under accession number OL342348. Its major metabolites were 2, 4-di-tert-butylphenol (40.44% area), trans-2-isopropyl-trans-5-methyl-1-hexene (17.34 area), tetradecane (12.08), hexadecane (11.56), and l-phe-d-pro lactam (7.78), (Table 8).
2,4-Di-tert-butylphenol is a common natural product that exhibits potent toxicity against almost all testing organisms, including bacteria and fungi species (53). The antimicrobial efficacy of dibutyl phthalate (DBP) has been reported from Streptomyces (54). Also, this compound shows strong activity against Gram-positive and Gram-negative bacteria, as well as unicellular and filamentous fungi (45).
Table 8- GC-MS Analysis of Pseudomonas gessardii Crude Extracts Isolated from Satureja khuzestanica
Strain MON05 was identified as P. azotoformans. It showed 99.66 % similarity to P. azotoformans strain D95_SO which was submitted to the GenBank under accession number OL342349. It is reported that P. azotoformans was used as an effective biocontrol bacterium against Colletotrichum orbiculare on cucumber (55). The findings of scholars indicated that P. azotoformans has efficacy on drought stress alleviation in wheat plants through various biochemical mechanisms. The P. azotoformans isolated from soil samples in China appeared to have strong inhibitory activities against Fusarium fujikuroi, a serious rice fungal pathogen. The identified metabolites from P. azotoformans include tetradecane (22.76 % area), 2,4-di-tert-butylphenol (22.44 % area), eicosane (10.40 % area), dodecane (10.88 % area), dibutyl phthalate, heptadecane, behenyl chloride, hexadecane, and isomenthone (Table 9).
Table 9- GC-MS Analysis of Pseudomonas Azotoformans Crude Extracts Isolated from Satureja khuzestanica
Rahbar et al (2012) found the good antimicrobial activity of tetradecane, hexadecanoic acid, and pentadecane against seven Gram-positive and Gram-negative bacteria (Bacillus subtilis, Enterococcus faecalis, S. aureus, Staphylococcus epidermidis, Escherichia coli, Pseudomonas aeruginosa, and Klebsiella pneumoniae), as well as three fungi (Candida albicans, Saccharomyces cerevisiae and Aspergillus niger) (56). Also, Hexadecane is reported for antibacterial and antioxidant activities. Bacterial strain MON 01 was identified as P. oryzihabitans and showed 99 % similarity to P. oryzihabitans strain ER34 which was submitted to the GenBank under accession number OL342350. In a study by Kleopatra Leontidou, P. oryzihabitansas was isolated as plant growth-promoting rhizobacteria from halophytes and drought-tolerant plants. Endophytic P. oryzihabitans was isolated from soybean grown in soil treated with glyphosate. The bacterium P. oryzihabitans was the most potent antagonistic bacteria which reduced disease incidence and severity compared to the untreated control (168-2016). So far, it has shown promising results as a potential biocontrol agent against plant parasitic nematodes (s0038). In the present study, metabolites from P. oryzihabitans were phenol,2-methyl-5- (1- methylethyl) or carvacrol (26.47 % area), 2,4-di-tert-butylphenol (26.06 % area), hexadecane (13.08 % area), and tetradecane (11.74 % area) (table10).
Table 10- GC-MS Analysis of Pseudomonas Oryzihabitans Crude Extracts Isolated from Satureja khuzestanica
All aspects of the interaction between microbes and plants are not fully understood. Nevertheless, more documents show that plant-associated microorganisms provide substantial benefits to agriculture and the environment. In brief, in this study, for the first time, bacterial endophytes were isolated from S. khuzestanica and their crude extracts showed notable inhibitory activities against tested phytopathogenic bacteria. The antibacterial analysis result of S. khuzestanica endophytic bacteria showed the potential use of these bacteria for the isolation of pure bioactive metabolites and the possibility of making new drugs. Further studies need to be carried out to isolate and identify pure active metabolites produced by S. khuzestanica endophytic bacteria.
The authors have no conflicts of interest to declare. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| مراجع | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
References
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
آمار تعداد مشاهده مقاله: 2,069 تعداد دریافت فایل اصل مقاله: 652 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||